Print

Please login or register.
1 Hour 1 Day 1 Week 1 Month Forever
Login with username, password and session length

[Zeful]

I just wondered a very specific thought.

Is Toady actually just coding details and then having them pass on, or is he making a DNA substitute for Dwarf Fortress? I know the RAWS apparently don't seem to have anything apparently confusing in them, but the way the game interprets them...

Code: [Select]

DF=DF  ; Dwarf -=- Dwarf  - Species
BR=GD  ; Brown -=- Gold  - Hair
BL=BL  ; Blue -=- Blue  - Eyes
...etc...

It could pose some very... interesting offspring when modded//hacked, like Half Dwarf/Half Magmaman.

Of course any result from having such a complicated system for values would only be way way way further down the line of development

This seems like a 50/50 thing. Hard to initialize but easy to code. You could take the system we have now for creatures and change it.

For example the parts of a dwarven body now are

Code: [Select]

HUMANOID:2EYES:2EARS:NOSE:2LUNGS:HEART:GUTS:ORGANS:HUMANOID_JOINTS:THROAT:NECK:SPINE:BRAIN:5FINGERS:5TOES:MOUTHA simple genetic code setup could be

Code: [Select]

X:X;DF:DF;BLU:Grn;LRG:sml;HK:but;CLN:CLN;STR:STR;low:HIGH;stf:stf;DMB:smt;AGL:clm With caps as dominate, lower case as recessive and split is shared dominate. Of course you would have to code the genetic order into the creature so that the line would have the proper context and everything, but once the framework is created it shouldn't be to hard.

[PTTG??]

I have a feeling that the raws will be simplified into this:
ATCGTAGTAACACATGTGCATGGATVAVATCAGTCAGCTATTAGGCGATAATCGCGCGCGCTAATCGATCTTAACTGTTTAGGGCTATATATCTATATTGATTACA
That being the raw code for pointed ears.

[Neonivek]

I have a feeling that the raws will be simplified into this:
ATCGTAGTAACACATGTGCATGGATVAVATCAGTCAGCTATTAGGCGATAATCGCGCGCGCTAATCGATCTTAACTGTTTAGGGCTATATATCTATATTGATTACA
That being the raw code for pointed ears.

The joke here being that you can spell the movie "Gataka" (or however it is spelled). Which was a movie of unnatural selection! (Basically those born without altered genes were ostracized and forced to be janitors).

What do you do if there are 4 genes for eyes at once?

[Sowelu]

The movie 'GATTACA' was named after sequences like these, with these four letters being the standard way of representing genetic sequences.

And if you really want to mess with genes, try crossbreeding plants in A Tale in the Desert.  It's a huge headache to map out genomes, and to figure out what compounds will move what parts to where.  But it's also very satisfying to add like five copies of an "increase flax production" sequence to a flax plant's genome.  I love that part of it.

[CobaltKobold]

XX as female and XY as male is ours, but there're other sex-determination chromosome patterns on Earth.

ex: Chickens: ZZ male, ZW female

[Duke 2.0]

 Also note, some frogs have three sex-determining genes known as X, Y and Z.

 I think Toady wants to keep them a bit more abstracted this time around. If there is a genome, it would likely be hidden. Genes are very efficient at storing data, but not so easy to modify. The RAW's would be much better as they are.

[Neonivek]

What about mutations?

That is mostly the reason I don't think the game should EXACTLY follow genetics.

It allows for much more interesting offspring and greater changes over time.

[Aqizzar]

Weighty stuff in the devlog.

Mud and blood splatters have definite volumes now, so they can only spread so far, and now when to form pools and blobs based on amounts.  Very cool.  I think blood fountains might actually be a reality soon.

Also, nerve damage.  I guess so you can roleplay that one Bond villain who couldn't feel pain.

Gonna be lots of new fun things to deal with as an Adventurer.

[Tormy]

What about mutations?

That is mostly the reason I don't think the game should EXACTLY follow genetics.

It allows for much more interesting offspring and greater changes over time.

Greater changes over time? I guess the worldgen must run for thousands of years if we would like to see "greater changes". It's not impossible of course, even with the current worldgen it shouldn't be problematic.

Also, nerve damage.  I guess so you can roleplay that one Bond villain who couldn't feel pain.

Yeah, and let's don't forget about Fortress mode also. We can mod in a "robocop" race even, if you know what I mean. 

[Kishmond]

There's already a modded race of superbots, if thet's what you're looking for.

[mendonca]

And if you really want to mess with genes, try crossbreeding ants in It Came From The Desert

This is what I read first time round ...

[Granite26]

Greater changes over time? I guess the worldgen must run for thousands of years if we would like to see "greater changes". It's not impossible of course, even with the current worldgen it shouldn't be problematic.

Why?  Mutation rate is variable.  Right now, Earth has something like 10^-4 to 10^-6 mutations per base pair per generation (people have 23 pairs)


There's not reason not to up it to 1% chance of mutation per 'gene' per generation, although you'd have to define mutation...  Color would be easy (RG or B value * .75-1.25 on mutation)

[Dareon Clearwater]

Also, nerve damage.  I guess so you can roleplay that one Bond villain who couldn't feel pain.

Or Thomas Covenant.

Hmm. ¤White Gold Ring¤.

[Mel_Vixen]

As long i suffocate to death cause i am covered with golddust. Hehehe.

Well toady can you give us an example how the tags for the genetics look?

[Hectonkhyres]

And if you really want to mess with genes, try crossbreeding ants in It Came From The Desert

This is what I read first time round ...

Now that is a movie I expect to see on the Scifi Channel.
Also, I now have an urge to hybridize dwarves and pea plants just to see what happens.