Bay 12 Games Forum

Please login or register.

Login with username, password and session length
Advanced search  
Pages: 1 ... 19 20 [21] 22 23 ... 71

Author Topic: LGBTQ+ Thread  (Read 78907 times)

Loud Whispers

  • Bay Watcher
  • They said we have to aim higher, so we dug deeper.
    • View Profile
    • I APPLAUD YOU SIRRAH
Re: LGBTQ+ Thread
« Reply #300 on: January 13, 2023, 05:08:37 am »

Pronouns "Associated With Deoxyribonucleic Acid"
hi my pronouns are TACGTCAGCTGACCTACGTCAGCTCAGCACGTAACCAGCTACGACTCTGCTCCAGACATGCT / CGATGCTAGCCGTTATCGATATGAGGCTAAGCAGCGATCTCGGTCCTGTCAAGTATGCA

(There isn't any easter egg hidden in there I just mashed keys.)
I'm GATTACA Binary uwu

Starver

  • Bay Watcher
    • View Profile
Re: LGBTQ+ Thread
« Reply #301 on: January 13, 2023, 06:00:42 am »

Enough with this DNA nonsense!

UGGCAUGCGACUGCACAUGCGCGUAAA
Logged

voliol

  • Bay Watcher
    • View Profile
    • Website
Re: LGBTQ+ Thread
« Reply #302 on: January 13, 2023, 09:04:57 am »

In biology, gametes are how "male" and "female" are defined.

So from the perspective of the study of biology you can always determine a gametic sex, sure.


It is not merely from the perspective of a study of biology, it is the most common meaning of the words woman and man, one used for many thousands of years, it is probably one of the earliest to arise because it was an important concept in everyday life of tribes.

Even before people had any idea about gametes, female was one who can bear children and male was one who provides seed. And woman and man are merely words to refer to adult human male and adult human female.

Therefore, phrases like "men can be pregnant" are absurd and go against the way how a huge majority of people understand the word "man". And yes, I am fully aware that other definitions exist and are in use by a growing. Yes, I understand what someone means when they say "a pregnant man." No, I don't think they are crazy or wicked or whatever.  I just don't see any sense in hijacking a word that already has a meaning and infusing it with a quite different meaning while trying to erase the previous meaning.

What the point of replacing a word "man" with "AMAB" (or similar) and not make a separate word for your new broader definition of a man? Why create confusion?

The common use of "man" and "woman" is "person who appears socially a man/woman", because no one takes a look at others gonads casually. Sure, there could be separate medical definitions where applicable, but I don't see how that would be less confusing than just referring to the body parts.

TD1

  • Bay Watcher
  • Childe Roland to the Dark Tower Came
    • View Profile
Re: LGBTQ+ Thread
« Reply #303 on: January 13, 2023, 09:41:54 am »

I tend to view it in terms of sex and gender. Sex is the Absolute Authority of Nature stamped on human flesh, gender is how the individual decides to interact with that.

Of course, I also view a priori gender claims to be completely irrelevant except on a personal level. Indeed, they're nonsensical when given any real-world application, as a biological definition of 'man' does not discriminate according to how one behaves, thinks, or dances nude in the streets.

Which doesn't mean gender's not without intense personal meaning! It fuels identity and forms community, much as similarly a priori claims to nationality do.
Logged
Life before death, strength before weakness, journey before destination
  TD1 has claimed the title of Penblessed the Endless Fountain of Epics!
Sigtext!
Poetry Thread

Horizon

  • Bay Watcher
  • Goodness, look the sun!
    • View Profile
Re: LGBTQ+ Thread
« Reply #304 on: January 13, 2023, 10:36:08 am »

I think people have penis' and others do not, and that's a-okay with me. People got their genders an' that's cool. Nobody should have a problem with that.
Logged
Go and Praise Mitsloe the artist of my avatar!

MorleyDev

  • Bay Watcher
  • "It is not enough for it to just work."
    • View Profile
    • MorleyDev
Re: LGBTQ+ Thread
« Reply #305 on: January 13, 2023, 10:48:40 am »

Even when dealing with Biological Sex a legal system that recognizes it as relevant to more than between patient/doctor has to deal with how it doesn't always fit neatly into the biological binary. People are sometimes born intersex and the law has to leave room for that, where the body may develop in a way that doesn't match the chromosomes or there is a mutation in the chromosomes. Turns out human invented categories always have examples that break them, just ask the Platypus.

----

And from a purely biological explanation for transexuality, a thought I've had that there's probably been research into I've missed and I fully accept I'm talking out my arse:

With my limited understanding of biology I know that when a fetus forms, it's always female first. Then other hormones come in and cause male traits to develop, but the template it's using as a starting point is female biology. And biology is not an exact process, so I can see plenty of room for things to go wrong. A male body forms but the brain develops in such a way that it 'expects' to interface with a female body. A female body remains but enough hormones happen that the brain develops in a way that it expects a male body. And all sorts of combinations of percentages in between.

Now, if that's the biological basis then there's two potential ways it can be 'addressed'. Either 'fix' the body so the brain can accept interfacing with it, or 'fix' the brain so it correctly accepts the body. But we aren't dealing with a simple chemical imbalance like can be addressed by SSRIs, so 'fixing' the brain is basically a no go. So you're left with doing what you can for the body to make the person's quality of life livable.

And again, the legal/social system has to cover the entire population of that society so has to accept this which means Lived Gender inherently becomes separate from Biological Sex as legal/social concepts.

Yes I'm aware this is probably the most coldly clinical way to talk about it, sorry about that.
« Last Edit: January 13, 2023, 11:03:02 am by MorleyDev »
Logged

Frumple

  • Bay Watcher
  • The Prettiest Kyuuki
    • View Profile
Re: LGBTQ+ Thread
« Reply #306 on: January 13, 2023, 11:09:22 am »

the law has to leave room for that
I mean, do note that one of the ways the law has "left room" for that historically is "non-consensual surgical procedures on children", so sometimes the room made is not exactly kind or comfortable or actually there, it can be less like a room and more like assault inflicted on infants. Sometimes humans look at something breaking their categories and choose violence :-\
Logged
Ask not!
What your country can hump for you.
Ask!
What you can hump for your country.

MorleyDev

  • Bay Watcher
  • "It is not enough for it to just work."
    • View Profile
    • MorleyDev
Re: LGBTQ+ Thread
« Reply #307 on: January 13, 2023, 11:18:32 am »

I wouldn't describe breaking things until they fit as 'making room', personally. Definitely not a good for approach for moving furniture either...

That's more the alternative approach of trying to remove them from the system entirely, which....yeah not a good approach.
« Last Edit: January 13, 2023, 11:21:11 am by MorleyDev »
Logged

Frumple

  • Bay Watcher
  • The Prettiest Kyuuki
    • View Profile
Re: LGBTQ+ Thread
« Reply #308 on: January 13, 2023, 11:21:29 am »

I mean, I wouldn't either, but the law damn sure would, ha.
Logged
Ask not!
What your country can hump for you.
Ask!
What you can hump for your country.

MorleyDev

  • Bay Watcher
  • "It is not enough for it to just work."
    • View Profile
    • MorleyDev
Re: LGBTQ+ Thread
« Reply #309 on: January 13, 2023, 11:57:39 am »

Completely off topic, but strictly speaking is there even such a thing as a consensual surgical procedure on a child? Being a child automatically means informed consent is impossible and so it's always via a proxy such as a parent.

Really only line of debate is determining what's a reasonable thing to enforce on a child compared to what is best left delayed until they are old enough to make an informed decision and give consent. And that will always fluctuate with culture.
Logged

Frumple

  • Bay Watcher
  • The Prettiest Kyuuki
    • View Profile
Re: LGBTQ+ Thread
« Reply #310 on: January 13, 2023, 12:14:39 pm »

Relatively possible -- not for infants, but younger children can understand things well enough to consent in some cases.

When it comes to intersex, though, it hasn't been particularly uncommon for the parent to not be informed, either. Doc just "fixes" it as a matter of course, and the law was by and large a-okay with that. Most of the point is just that legal systems don't actually have to recognize the fiddly bits of intersex folks, it's perfectly (and historically) capable of just eliminating them by force.
Logged
Ask not!
What your country can hump for you.
Ask!
What you can hump for your country.

Grim Portent

  • Bay Watcher
    • View Profile
Re: LGBTQ+ Thread
« Reply #311 on: January 13, 2023, 01:54:30 pm »

I wouldn't say the elimination of intersex people was necessarily forceful or deliberate, more so just misguided charity, unlike the cruelty various other groups that are more classically LGBTQ+ faced.

Being intersex was viewed much like having a cleft palate, it was a disability, a deformity that would condemn the person to suffering if it wasn't fixed. Suffering either caused directly by their body not working 'correctly,' or suffering caused by others being cruel and stupid. The desire to conform isn't uncommon among people who get bullied for physical differences or disabilities.

Not great reasoning, but I can understand where the doctors were coming from when they did those procedures. Indeed, were I a doctor who delivered an intersex baby in the 1950s I would probably consider the surgery to be better long term than the increased risk of bullying, sexual assault, suicide and murder that the child would likely face without it.
Logged
There once was a dwarf in a cave,
who many would consider brave.
With a head like a block
he went out for a sock,
his ass I won't bother to save.

Vector

  • Bay Watcher
    • View Profile
Re: LGBTQ+ Thread
« Reply #312 on: January 13, 2023, 03:11:03 pm »

[I had a different post written here which worked from a false premise--see McTraveller's post below and my response. It was a bad post written with a hangover and I regret not being more careful to check information. Maybe I'll try again later.]
« Last Edit: January 13, 2023, 06:24:39 pm by Vector »
Logged
"The question of the usefulness of poetry arises only in periods of its decline, while in periods of its flowering, no one doubts its total uselessness." - Boris Pasternak

nonbinary/genderfluid/genderqueer renegade mathematician and mafia subforum limpet. please avoid quoting me.

pronouns: prefer neutral ones, others are fine. height: 5'3".

McTraveller

  • Bay Watcher
  • This text isn't very personal.
    • View Profile
Re: LGBTQ+ Thread
« Reply #313 on: January 13, 2023, 03:39:10 pm »

Dunno about the other claims, but 9 for menarche isn't anywhere close to "average", though that is about the earliest possible.

Remember that the difference between 9 and 11 is about 20% of their life at that point - hence the "not close" hyperbole.
Logged
This product contains deoxyribonucleic acid which is known to the State of California to cause cancer, reproductive harm, and other health issues.

Vector

  • Bay Watcher
    • View Profile
Re: LGBTQ+ Thread
« Reply #314 on: January 13, 2023, 06:16:23 pm »

Dunno about the other claims, but 9 for menarche isn't anywhere close to "average", though that is about the earliest possible.

Remember that the difference between 9 and 11 is about 20% of their life at that point - hence the "not close" hyperbole.

Thank you VERY much for the correction. My comment was based on some half-remembered (and now I clearly see, fear-mongering) claims about puberty in the US starting at younger and younger ages that were common discussion in my teenaged years. In retrospect that's an obvious error in terms of statistical implications, but well, whatever. It's a mistake.

I'm going to modify the post...
« Last Edit: January 13, 2023, 06:18:28 pm by Vector »
Logged
"The question of the usefulness of poetry arises only in periods of its decline, while in periods of its flowering, no one doubts its total uselessness." - Boris Pasternak

nonbinary/genderfluid/genderqueer renegade mathematician and mafia subforum limpet. please avoid quoting me.

pronouns: prefer neutral ones, others are fine. height: 5'3".
Pages: 1 ... 19 20 [21] 22 23 ... 71