Bay 12 Games Forum

Please login or register.

Login with username, password and session length
Advanced search  
Pages: 1 ... 18 19 [20] 21 22 ... 71

Author Topic: LGBTQ+ Thread  (Read 71955 times)

Rolan7

  • Bay Watcher
  • [GUE'VESA][BONECARN]
    • View Profile
Re: LGBTQ+ Thread
« Reply #285 on: January 11, 2023, 10:50:51 am »

Re: "people who own a vagina"

Yeah it's weird, "gender critical" "feminists" kept defining women as people with vaginas.  I mean people with working vaginas and ovum and XX chromosomes well maybe some other chromosomes look the chromosomes don't matter we can just tell by looking.  Well okay THOSE trans wo- those people sure looked like women but that's terrifying so I won't call them that word.  Look we just want our single-sex safe spaces to be safe, and trans people make those spaces unsafe by constantly getting assaulted by us.  Or tricking us into assaulting other cis people.  I mean "normal" people, "cis" is a hateful slur actually.  I refuse to say "cis" or "not trans" or "woman" because those words are very scary to me.  I'm normal!  I'm normal!  You other normal people know exactly what I mean by normal, right?  woah ixnay on the pitchforks, it's too soon

Those trans people are always saying "man" and "woman", ugh.  Unless they're talking about medical situations like abortion, when suddenly they go for medical terminology?  It's like they're not even *trying* to reduce womanhood to having a fertilizable womb!  Don't they know that using specific and inclusive language just emboldens people?  We need people *scared* dammit!  Scared of those non-normal people!  They're a threat to us, you can tell because they aren't normal like us!  Stop calling them men and women, it... normalizes them.

We should only talk about us biological women (AKA real women also don't ask me to define that, bigot) and the men who own our vaginas.

/TERF- oh, sorry, "gender critical", because they decided being a radical feminist was a slur and demanded we stop using the word.  Calling them feminists was always fucked anyway
Logged
She/they
No justice: no peace.
Quote from: Fallen London, one Unthinkable Hope
This one didn't want to be who they was. On the Surface – it was a dull, unconsidered sadness. But everything changed. Which implied everything could change.

Rolan7

  • Bay Watcher
  • [GUE'VESA][BONECARN]
    • View Profile
Re: LGBTQ+ Thread
« Reply #286 on: January 11, 2023, 11:01:40 am »

Actually maybe that post doesn't make any sense and I've been spending too much time on twitter, lemme try again:

I've found that anti-trans people seem the most confused and reluctant to use "man" and "woman", instead talking about various physical things like vaginas or chromosomes.  They're fine terms.  For certain situations like reproductive health though, it's a lot more accurate *and* inclusive to describe demographics who can become pregnant or impregnate.

Even for cis people, gender is so much more than reproductive function!
Logged
She/they
No justice: no peace.
Quote from: Fallen London, one Unthinkable Hope
This one didn't want to be who they was. On the Surface – it was a dull, unconsidered sadness. But everything changed. Which implied everything could change.

alway

  • Bay Watcher
  • 🏳️‍⚧️
    • View Profile
Re: LGBTQ+ Thread
« Reply #287 on: January 11, 2023, 11:31:43 am »

I just find it humourous that people are afraid to say 'man' and 'woman' now. I say this because I'm currently reading an article which references 'people who own a vagina' and 'people with a penis'

And I'm just like

.... lol?
That's not fear, it's accuracy. As to why this matters, here's a bit of an anecdote: I know a man who became pregnant; it was unplanned, unintended, but nonetheless something he would have been happy to take to completion and given birth to a child who would have been loved dearly by him and his partner. He found out he was pregnant when he had the miscarriage.

As many would be, he was kinda fucked up over this. He sought out support, and found group therapy nearby. He got there, and they saw his beard, heard his deep voice, and informed him that this was a therapy session for women who experienced miscarriages, not men, who were unable to. He was turned away.


Something to understand here: this isn't a one-off. When you are in a marginalized group, this is how every single interaction regarding basic healthcare goes unless care is taken to properly define who things apply to. You might say "close enough, ignore the outliers," but the thing about outliers is, it's the same people 100% of the time, who now get their basic needs ignored 100% of the time. That's not an outlier, that's incredibly harmful oppression of a group on the grounds of said group being small.

As another example of this: the case of Robert Eads. He was a trans man diagnosed with ovarian cancer. He went to around 20 different doctors, all of whom refused to treat him; after all, gynecologists treat women, not men! By the time he found a doctor willing to treat his cancer an entire year later, it had already grown and was beyond what could be dealt with. He died 2 years later at age 53.
Logged

GadgetPatch

  • Bay Watcher
    • View Profile
Re: LGBTQ+ Thread
« Reply #288 on: January 11, 2023, 11:46:07 am »

Yeah. Less life-threatening version of this is how I can't get an endometriosis diagnosis/get it covered by insurance, because of my nebulous legal gender status (depending on whether you ask the US federal or state government).

I say this to show it happens to all kinds of people. The way gendered language gets baked not only into social mores, but also into laws and everyday procedures, is ridiculous and unfortunate. It's not just what words people use.
Logged

McTraveller

  • Bay Watcher
  • This text isn't very personal.
    • View Profile
Re: LGBTQ+ Thread
« Reply #289 on: January 11, 2023, 10:02:05 pm »

 :o Sounds like bad situations resulting from people not respecting that a physical (as in, the laws of physics physical) <X> by any other name (identifier/label) is still physically an <X>, so laws are based on what <X> is named/labeled, not what <X> is.

I can't fathom why you'd base available medical care based on a label rather than on what organs and biochemistry are present.

A less controversial example is laws like "oh that aluminum can holds water, not sugary soft drinks or beer, so it's not subject to recycling deposit/refund laws."
Logged
This product contains deoxyribonucleic acid which is known to the State of California to cause cancer, reproductive harm, and other health issues.

Strongpoint

  • Bay Watcher
    • View Profile
Re: LGBTQ+ Thread
« Reply #290 on: January 12, 2023, 02:08:16 am »

Quote
As another example of this: the case of Robert Eads. He was a trans man diagnosed with ovarian cancer. He went to around 20 different doctors, all of whom refused to treat him; after all, gynecologists treat women, not men! By the time he found a doctor willing to treat his cancer an entire year later, it had already grown and was beyond what could be dealt with. He died 2 years later at age 53.

WTF? It sounds absurdly disgusting. I can't imagine something like that happening here. Sure, chances are that a patient like this will receive long lectures about their sanity (and\or morality) from the doctor but outright refusal to treat from ~20 doctors?
Logged
They ought to be pitied! They are already on a course for self-destruction! They do not need help from us. We need to redress our wounds, help our people, rebuild our cities!

TD1

  • Bay Watcher
  • Childe Roland to the Dark Tower Came
    • View Profile
Re: LGBTQ+ Thread
« Reply #291 on: January 12, 2023, 04:53:13 am »

Actually maybe that post doesn't make any sense and I've been spending too much time on twitter, lemme try again:

I've found that anti-trans people seem the most confused and reluctant to use "man" and "woman", instead talking about various physical things like vaginas or chromosomes.  They're fine terms.  For certain situations like reproductive health though, it's a lot more accurate *and* inclusive to describe demographics who can become pregnant or impregnate.

Even for cis people, gender is so much more than reproductive function!
Truly, Twitter is the bane of legibility.

I find there's a point where the language becomes ridiculous, which doesn't help anyone. Presented with the phrase 'people who own a vagina' I envisaged someone with a vagina as a pet, or who possessed the deed to a vagina.

I snorted a laugh, which is probably not what you want.

Edit: Also, I'd like to apologise for the tone of my previous message. I stand by its sentiment, but not its wording - which I now see to be slightly incendiary.
« Last Edit: January 12, 2023, 08:13:43 am by TD1 »
Logged
Life before death, strength before weakness, journey before destination
  TD1 has claimed the title of Penblessed the Endless Fountain of Epics!
Sigtext!
Poetry Thread

Rolan7

  • Bay Watcher
  • [GUE'VESA][BONECARN]
    • View Profile
Re: LGBTQ+ Thread
« Reply #292 on: January 12, 2023, 09:13:06 am »

Ah don't worry, "people who own vaginas" just reminded me so much of anti-trans Twitter.  They really do use phrases like that, reducing "men" and "women" to gametes.  They really aren't consistent either, hence me rambling about chromosomes and appearance too.

It's pretty weird to see them parroting their definitions of womanhood in response to everything, since they're conflicting definitions?  And it's not disagreement among their ranks - an individual will swap instantly between definitions when you respond, and see no hypocrisy there.  Truly, a woman is defined as "Not a trans woman" to them.

I sorta considered posting some of the particularly wacky arguments I've gotten (that's basically what that rant was).  Engaging with them can be insidiously fun, particularly when they're sooooo off the mark.  It's so easy to get a "You will never be a man" from them by acting like a trans man - without lying!  Just being my gender-fluid self!  That can be really... affirming?  Not because they're the arbiters of gender, but because it reveals just how flimsy their anti-trans ideology is.  It's that relaxing feeling of confirming that they have no attacks of substance.

Of course I'm small enough not to be doxxed or have (many) death threats spammed at me, and I'm pretty stealth in my actual life, so I'm emotionally able to enjoy such frivolity.  It can stop being funny real quick.

Anyway yeah, some women can't get pregnant (trans or otherwise) and some men can get pregnant.  There's this one guy I know who moderates a chat, he's going off his hormones for a whole year to do it.  I'm not sure how to describe how huge that is to someone who doesn't need HRT.  Truly some mind-over-matter and dedication to his goal.  IDK, I just think about that a lot.  If it was just an ideology/fad/whatever, who would ever do that??  But these guys do!  I guess most people see a pregnant guy and don't see an absolute king doing something unthinkably brave...
Logged
She/they
No justice: no peace.
Quote from: Fallen London, one Unthinkable Hope
This one didn't want to be who they was. On the Surface – it was a dull, unconsidered sadness. But everything changed. Which implied everything could change.

Starver

  • Bay Watcher
    • View Profile
Re: LGBTQ+ Thread
« Reply #293 on: January 12, 2023, 09:42:59 am »

Straying into just the normal gender divide, I have to admire all who go through with carrying a pregnancy (and, with suitable sympathies, also those that could not do so but were actually prepared to/had to deal with it). Biology must grant something that I cannot even comprehend to make it a 'normal' part of one's path in life.

And the additional pressures from social and cultural issues cannot help at all, whether it's counter or in addition to biology and/or identity.
Logged

Strongpoint

  • Bay Watcher
    • View Profile
Re: LGBTQ+ Thread
« Reply #294 on: January 12, 2023, 12:59:18 pm »

Quote
They really do use phrases like that, reducing "men" and "women" to gametes. 

Well, gametes ARE the most convenient way to determine if an organism is male or female. 

And this reminds me something I often hear in other parts of Twitter... Oh... Yes... religious folks "How can you reduce humans to animals?"
Logged
They ought to be pitied! They are already on a course for self-destruction! They do not need help from us. We need to redress our wounds, help our people, rebuild our cities!

Maximum Spin

  • Bay Watcher
  • [OPPOSED_TO_LIFE] [GOES_TO_ELEVEN]
    • View Profile
Re: LGBTQ+ Thread
« Reply #295 on: January 12, 2023, 02:08:48 pm »

Well, gametes ARE the most convenient way to determine if an organism is male or female. 
In biology, gametes are how "male" and "female" are defined. From a biological perspective, every human can be classified into one of those two categories with no overlap, based on gametes - even everyone with a DSD, since no human being has ever been found to produce both gametes, and this is almost certainly impossible because the systems that allow their production are in absolute competition. There are, of course, people who produce neither gamete for one reason or another, but it's always possible to trace the developmental pathway backward and determine what "would have been".

So from the perspective of the study of biology you can always determine a gametic sex, sure.
Logged

Starver

  • Bay Watcher
    • View Profile
Re: LGBTQ+ Thread
« Reply #296 on: January 12, 2023, 03:46:30 pm »

...though I'd hardly call it "the most convenient way". You can perhaps confirm clear-cut cases reasonably easily through easy to obtain samples, but when there's already ambiguity it starts to be even more involved and potentially invasive.
Logged

Rolan7

  • Bay Watcher
  • [GUE'VESA][BONECARN]
    • View Profile
Re: LGBTQ+ Thread
« Reply #297 on: January 12, 2023, 10:01:16 pm »

"Yeah you know what's more convenient?  DNA sequencing" - North Dakota, apparently

North Dakota Bill Would Require Employers Use Pronouns "Associated With Deoxyribonucleic Acid"

How is anyone this silly...
(They aren't.  The cruelty is the point, these bills are designed to scare their targets and maybe shift the Overton window for more "reasonable" bills.  Or maybe the Supreme Court just allows something like this, why wouldn't they?)
Logged
She/they
No justice: no peace.
Quote from: Fallen London, one Unthinkable Hope
This one didn't want to be who they was. On the Surface – it was a dull, unconsidered sadness. But everything changed. Which implied everything could change.

Egan_BW

  • Bay Watcher
  • The questioner does not.
    • View Profile
Re: LGBTQ+ Thread
« Reply #298 on: January 13, 2023, 04:41:33 am »

Pronouns "Associated With Deoxyribonucleic Acid"
hi my pronouns are TACGTCAGCTGACCTACGTCAGCTCAGCACGTAACCAGCTACGACTCTGCTCCAGACATGCT / CGATGCTAGCCGTTATCGATATGAGGCTAAGCAGCGATCTCGGTCCTGTCAAGTATGCA

(There isn't any easter egg hidden in there I just mashed keys.)
Logged

Strongpoint

  • Bay Watcher
    • View Profile
Re: LGBTQ+ Thread
« Reply #299 on: January 13, 2023, 04:49:48 am »

In biology, gametes are how "male" and "female" are defined.

So from the perspective of the study of biology you can always determine a gametic sex, sure.


It is not merely from the perspective of a study of biology, it is the most common meaning of the words woman and man, one used for many thousands of years, it is probably one of the earliest to arise because it was an important concept in everyday life of tribes.

Even before people had any idea about gametes, female was one who can bear children and male was one who provides seed. And woman and man are merely words to refer to adult human male and adult human female.

Therefore, phrases like "men can be pregnant" are absurd and go against the way how a huge majority of people understand the word "man". And yes, I am fully aware that other definitions exist and are in use by a growing. Yes, I understand what someone means when they say "a pregnant man." No, I don't think they are crazy or wicked or whatever.  I just don't see any sense in hijacking a word that already has a meaning and infusing it with a quite different meaning while trying to erase the previous meaning.

What the point of replacing a word "man" with "AMAB" (or similar) and not make a separate word for your new broader definition of a man? Why create confusion?
Logged
They ought to be pitied! They are already on a course for self-destruction! They do not need help from us. We need to redress our wounds, help our people, rebuild our cities!
Pages: 1 ... 18 19 [20] 21 22 ... 71